ONLINE MANUALS LOGIN
BCPC’s Knowledge Bank provides access to a wealth of research from past BCPC Congresses and Symposia. This resource contains over 64,000 pages dating back to 1954 through to 2009.
Return to Index of Publication Titles (Further titles are in the process of being added in the coming weeks)
OR: Use simple keyword search to find documents of interest.
| Publication Title. | Excerpt | Publication date | View/download PDF |
| BCPC Congress 2007 6B – Resistance | ...published works that document examples for almost all commercially available compounds. A number ofspecies are primary targets of neonicotinoid insecticides that in some cases now constitute the predominant componentof control... | 2007 |  view PDF |
| BRITISH WEED CONTROL CONFERENCE 1960 VOL 1 Part-1-of-3 | ...it very sensible to ask for trouble, The impact of herbicides on farming methods has generally been complimentary to established practice, Therein lies their value, not, I suggest, in the... | 1960 | view PDF |
| BCPC Weeds Conference 1978 Vol II p451-481 | ...latter compatible with those practised by the Official Seed Testing Stations, but the authors do not believe that the results will be substantially different. Microwave radiation has been applied to... | view PDF | |
| Pesticide Behaviour in Soils and Water – Session 8 Risk Management I | ...(2001). National Center for Food and Ag. Policy, Science, 292 (5517) :637. Carpenter J E; Gianessi L P (2001). Agricultural biotechnology: updated benefits estimates. National Center for Food and Agricultural... | view PDF | |
| BCPC Pests and Diseases Conference 1979 – Soft Fruit and Hops Papers 30-31 | ...(0.3% a.i.). The following year treat- ments were applied on 20 September at 250 ml/plant and in the third year on 8th Sep- tember at 300 ml/plant. The formulation of... | view PDF | |
| BCPC Weeds Conference Vol 1 Session 2A | ...Plot size was 20 - 45 m2 for hand sprayed plots and 60 - 90 m2 for Land Rover sprayed plots. The spray volume was between 250 - 500 l/ha,... | view PDF | |
| Microbial Insecticides – Novelty or Necessity – Posters I | ...the 5′ (5’ACCCGTTACAGTTACAATCCG3′, nt 5′-7 to 3′-28) and 3 (5’GGCGGGTCCGTTGTACAGAGG3′, nt 3′-735 to 5′-714) regions of the 740 bp polyhedrin gene coding region of MbMNPV(ref). Control MoDMNPV DNA (25 ng)... | view PDF | |
| Field Margins – Restoration and Creation Posters 2 A | ...treatments were imposed: 1. Unchanged control - Control 2. Laid - Lay 3. Cut to 1.5 m high with stem bases nicked to encourage sprouting - Pollard 4. Coppiced with... | view PDF | |
| BCPC Weeds Conference – Vol 1 Session 4B | ...+ 0.375) Species Expt 1987 1988 1989 1990 no. S. media (a)* 1 2.89 -28 15 6.34 2 - 215 -11 -783 S. media (b)** . .26 .28 6.35 314... | view PDF | |
| WRO Technical Report Number 36 | ...yl-1,3,4-thiadiazol-2~-yl) urea oe eo NS CH.-C- Il Il -N-C-NHCH Sr ee it 3 CH. S Structure G Eli Lilly Lilly Research Centre Ltd Erl Wood Manor Windlesham Surrey Information available... | view PDF | |
| Biotechnology in Crop Protection – Public concerns | ...ten-year monitoring period be instituted when a specific genetically modified crop is commercially grown in the UK for the first time’. The fourth Annual Report of the Advisory Committee on... | view PDF | |
| BCPC Congress 2003 – Session 5D Prediction and Precision | ...made with an assurance that long- term management sustainability is being served. A further, and perhaps the crucial, element of sustainability for the farmer and the rural community is that... | 2003 | view PDF |
| 3. REV Iain-Watt-Natural-substances-as-PPP | ...does not have a separate framework for bioprotectants when compared with regions of similar, or even smaller, sizes due to its complex regulatory system. Introduction – Natural substances 7© TSG... | view PDF | |
| Preface 19th Edition | ...has recently assumed responsibility for the popular online Compendium of Pesticide Common Names, developed and edited for many years by Alan Wood. The Compendium provides basic information (nomenclature, structure, uses,... | view PDF | |
| Gene Flow and Agriculture – Consequences of between species p109-124 | ...B. napus chromosomeswerelost. The 13 seeds obtained from the backcross B. napus x [B. napus x E. gallicum] are being grown out to determine if they are true hybrids. In... | view PDF | |
| Pesticide Behaviour in Soils and Water – Sorption and Mobility Posters II | ...and D,(N>) is the fractal dimensionofthe surface accessible to nitrogen. D,(N2) can be obtained from the slope of the plot of log (Vags) against log [log (po/p)] in the low... | view PDF | |
| The Global Challenge – Sustainable Food Production – Market Demands | ...the comment: “It is a moral responsibility of all societies, communities and individuals to ensure that hungeris eradicated. It is the suffering endured by the world’s hungry that keeps the... | view PDF | |
| BCPC Pests and Diseases Vol 1 – Session 1 | ...regul ation comes into being, are completely unknown. These two important pro blems introduce an element of risk into all genetic engineering proj ects. An additional strategic problem in evaluation... | view PDF | |
| Insect Pheromones And Other Behaviour Modifying Chemicals Session 1 and 2 | ...in combination with the tier-testing approach provided under current US biochemical and microbial regulatory guidelines, could provide a process for reducing toxicol- ogy data requirements without compromisingsafety. Potential pheromone residues... | view PDF | |
| British Weed Control Conference 1954 – Vol II – Woody Weeds | ...and a further experiment to test these treatments on leleshwa was carried out recently. (ii) Commiphora spp. and Euphorbia matabelensis. In an experiment on two species of Commiphora (C.schimperi and... | view PDF |
